ID: 1083553755_1083553764

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083553755 1083553764
Species Human (GRCh38) Human (GRCh38)
Location 11:63609789-63609811 11:63609840-63609862
Sequence CCAAAGGTCATAAACATCCTGGA AGACTTTGACCACCAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 338} {0: 1, 1: 0, 2: 0, 3: 29, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!