ID: 1083571996_1083572007

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083571996 1083572007
Species Human (GRCh38) Human (GRCh38)
Location 11:63765923-63765945 11:63765967-63765989
Sequence CCCAGCCCCAGGTGTGCATCCCA CTCCCGGGGACTCCAATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 412} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!