ID: 1083587648_1083587653

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083587648 1083587653
Species Human (GRCh38) Human (GRCh38)
Location 11:63872180-63872202 11:63872198-63872220
Sequence CCTCTCTGTGGCAGCCTTGGGCT GGGCTGTGTTCTGGAAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 291} {0: 1, 1: 0, 2: 1, 3: 34, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!