ID: 1083588517_1083588523

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083588517 1083588523
Species Human (GRCh38) Human (GRCh38)
Location 11:63877995-63878017 11:63878046-63878068
Sequence CCACTTAGTAACAGGATCCGGTT AGTGGCAAGCCCAGTAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46} {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!