ID: 1083594003_1083594018

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1083594003 1083594018
Species Human (GRCh38) Human (GRCh38)
Location 11:63910447-63910469 11:63910488-63910510
Sequence CCAGCTTGCTACCCTCAGTGGCC TTGGGGCGCTTGGCTGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159} {0: 1, 1: 0, 2: 1, 3: 16, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!