ID: 1083606600_1083606611

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1083606600 1083606611
Species Human (GRCh38) Human (GRCh38)
Location 11:63982647-63982669 11:63982700-63982722
Sequence CCCTACTCCCGCTGTCTGGGCAG GGTCGCCTAATCCCCATGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137} {0: 1, 1: 0, 2: 0, 3: 47, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!