ID: 1083607704_1083607714

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1083607704 1083607714
Species Human (GRCh38) Human (GRCh38)
Location 11:63988640-63988662 11:63988689-63988711
Sequence CCTGCCTCCTCCAGATTGCTGTG GGAGCTCTCGGTCCTATACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 476} {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!