ID: 1083608221_1083608229

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083608221 1083608229
Species Human (GRCh38) Human (GRCh38)
Location 11:63991820-63991842 11:63991856-63991878
Sequence CCCTCACAAAACTTACAGTTCAG GATAAGCCAAAGAGGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 45, 4: 439} {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!