ID: 1083616030_1083616044

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083616030 1083616044
Species Human (GRCh38) Human (GRCh38)
Location 11:64027141-64027163 11:64027192-64027214
Sequence CCGATGTCACAGAGGGTTAGCAG TGGCTGAGAGGAGGGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129} {0: 1, 1: 1, 2: 10, 3: 92, 4: 999}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!