ID: 1083618075_1083618087

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1083618075 1083618087
Species Human (GRCh38) Human (GRCh38)
Location 11:64036126-64036148 11:64036147-64036169
Sequence CCCGAGGAGACCCGCCTCCCCGG GGCCGCTGCGCAGGTAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169} {0: 1, 1: 0, 2: 5, 3: 29, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!