ID: 1083622752_1083622757

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1083622752 1083622757
Species Human (GRCh38) Human (GRCh38)
Location 11:64057066-64057088 11:64057097-64057119
Sequence CCAGCCTGCGTCGCACCAGCTCT AGGGCTTCCTGTGTGTTCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 136} {0: 1, 1: 0, 2: 1, 3: 27, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!