ID: 1083632742_1083632747

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1083632742 1083632747
Species Human (GRCh38) Human (GRCh38)
Location 11:64104150-64104172 11:64104178-64104200
Sequence CCAGAGGGTCTTGGGCGGCAGCG GGAGGTAAGGCCCAAGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 0, 3: 18, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!