ID: 1083636045_1083636053

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1083636045 1083636053
Species Human (GRCh38) Human (GRCh38)
Location 11:64121498-64121520 11:64121519-64121541
Sequence CCCCCAAATATCTGCTGTGTCAC ACAGCCCCTCAGCCAGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 243} {0: 1, 1: 0, 2: 2, 3: 36, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!