ID: 1083646574_1083646586

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1083646574 1083646586
Species Human (GRCh38) Human (GRCh38)
Location 11:64174944-64174966 11:64174963-64174985
Sequence CCCACGCCACCCTCCCCAGGGGA GGGAAGGGCCTTAGTGGGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!