ID: 1083652672_1083652676

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083652672 1083652676
Species Human (GRCh38) Human (GRCh38)
Location 11:64212194-64212216 11:64212212-64212234
Sequence CCCTCTGTGCCCTGTTCACTCTT CTCTTCCTCCCTTCCTCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 387} {0: 1, 1: 0, 2: 6, 3: 67, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!