ID: 1083656799_1083656815

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083656799 1083656815
Species Human (GRCh38) Human (GRCh38)
Location 11:64234004-64234026 11:64234052-64234074
Sequence CCCTGCTCCCTGTCCAGGAACCA CCCAGGTGCCCTCTCCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 330} {0: 1, 1: 0, 2: 8, 3: 42, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!