ID: 1083656805_1083656807

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083656805 1083656807
Species Human (GRCh38) Human (GRCh38)
Location 11:64234017-64234039 11:64234035-64234057
Sequence CCAGGAACCACACTTCGGGATCC GATCCCTATCCCAACCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 263} {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!