ID: 1083657360_1083657375

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083657360 1083657375
Species Human (GRCh38) Human (GRCh38)
Location 11:64235956-64235978 11:64236004-64236026
Sequence CCTGACGATGGCCTGGAGTGTGT ATGCAGGTACTGGGCAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83} {0: 2, 1: 0, 2: 3, 3: 40, 4: 1031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!