ID: 1083662637_1083662649

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1083662637 1083662649
Species Human (GRCh38) Human (GRCh38)
Location 11:64258918-64258940 11:64258970-64258992
Sequence CCGCTCCATCTTTGGAGACGCGC GTACGGGAGCTCGGAGCGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58} {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!