ID: 1083662889_1083662907

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1083662889 1083662907
Species Human (GRCh38) Human (GRCh38)
Location 11:64260006-64260028 11:64260058-64260080
Sequence CCCTGTGGCCCTGTCCTCTGCAG CTGAGCAATGGGGAGGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 428} {0: 1, 1: 0, 2: 5, 3: 71, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!