ID: 1083667599_1083667609

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083667599 1083667609
Species Human (GRCh38) Human (GRCh38)
Location 11:64284418-64284440 11:64284462-64284484
Sequence CCAACGGTGGCCCTGGAAGGCAG TCTCCCACCGTAGCGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 213} {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!