ID: 1083673111_1083673119

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1083673111 1083673119
Species Human (GRCh38) Human (GRCh38)
Location 11:64310870-64310892 11:64310916-64310938
Sequence CCAAAATCCACCAATCTTAAACT GAACAGTGAGCCAGCCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 286} {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!