ID: 1083673114_1083673120

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083673114 1083673120
Species Human (GRCh38) Human (GRCh38)
Location 11:64310900-64310922 11:64310917-64310939
Sequence CCCTTCCCACTCTGAAGAACAGT AACAGTGAGCCAGCCGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 254} {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!