ID: 1083674811_1083674820

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083674811 1083674820
Species Human (GRCh38) Human (GRCh38)
Location 11:64319315-64319337 11:64319351-64319373
Sequence CCTCCTGAGGGTGGGACCCTCAG CCTCTCCCTCCATGTTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213} {0: 1, 1: 0, 2: 1, 3: 29, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!