ID: 1083681593_1083681604

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083681593 1083681604
Species Human (GRCh38) Human (GRCh38)
Location 11:64354143-64354165 11:64354169-64354191
Sequence CCTGAGGGCAGGGAGGCAGATGG AGGTGGGTCTGGGGGTCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 95, 4: 673} {0: 1, 1: 2, 2: 4, 3: 91, 4: 799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!