ID: 1083683488_1083683499

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1083683488 1083683499
Species Human (GRCh38) Human (GRCh38)
Location 11:64361909-64361931 11:64361948-64361970
Sequence CCTGCTGCAGCGGCTGCTTTGTA ATTGGGCGCGGGGCCCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171} {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!