ID: 1083706337_1083706342

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1083706337 1083706342
Species Human (GRCh38) Human (GRCh38)
Location 11:64518843-64518865 11:64518875-64518897
Sequence CCTGGAGTAGGGGTCAATTCTGG CTTGCTGCTCCCTCCAGTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 19, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!