ID: 1083713706_1083713723

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083713706 1083713723
Species Human (GRCh38) Human (GRCh38)
Location 11:64564014-64564036 11:64564064-64564086
Sequence CCAGGCCACCTGTGCCCTGGCTG GGGCAGCCAGGCGAGCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 504} {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!