ID: 1083713707_1083713717

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083713707 1083713717
Species Human (GRCh38) Human (GRCh38)
Location 11:64564019-64564041 11:64564043-64564065
Sequence CCACCTGTGCCCTGGCTGTGTGC GGGCTCAGGTGGGCAGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 415} {0: 1, 1: 0, 2: 4, 3: 71, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!