ID: 1083713712_1083713724

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1083713712 1083713724
Species Human (GRCh38) Human (GRCh38)
Location 11:64564029-64564051 11:64564067-64564089
Sequence CCTGGCTGTGTGCAGGGCTCAGG CAGCCAGGCGAGCCAGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 755} {0: 1, 1: 0, 2: 2, 3: 18, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!