ID: 1083715563_1083715565

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083715563 1083715565
Species Human (GRCh38) Human (GRCh38)
Location 11:64573614-64573636 11:64573640-64573662
Sequence CCACTACAAATCTAGGACTACGA CGAACATTAAAACGATAATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 39, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!