ID: 1083721587_1083721596

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1083721587 1083721596
Species Human (GRCh38) Human (GRCh38)
Location 11:64606332-64606354 11:64606355-64606377
Sequence CCTTGCTCCCTCTTCCCTGCTGC CCGCGCCCAGCGGGTGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 154, 4: 1224} {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!