ID: 1083731021_1083731029

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083731021 1083731029
Species Human (GRCh38) Human (GRCh38)
Location 11:64652754-64652776 11:64652778-64652800
Sequence CCACACGTACTGCCCATAAATAT CAGGATGGCCAGAGAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} {0: 1, 1: 0, 2: 5, 3: 67, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!