ID: 1083731286_1083731299

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083731286 1083731299
Species Human (GRCh38) Human (GRCh38)
Location 11:64653922-64653944 11:64653957-64653979
Sequence CCAACCCTCCCCAGAGCTGGAAG GATGATGGGAAGAGGGCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 411} {0: 1, 1: 0, 2: 2, 3: 48, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!