ID: 1083731293_1083731299

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083731293 1083731299
Species Human (GRCh38) Human (GRCh38)
Location 11:64653931-64653953 11:64653957-64653979
Sequence CCCAGAGCTGGAAGGCAGGGCAG GATGATGGGAAGAGGGCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 483} {0: 1, 1: 0, 2: 2, 3: 48, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!