ID: 1083747816_1083747843

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083747816 1083747843
Species Human (GRCh38) Human (GRCh38)
Location 11:64745129-64745151 11:64745177-64745199
Sequence CCCCTCCCCCAACCGCGGACGCC GTCGGGCGGAGGAAGCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216} {0: 1, 1: 0, 2: 1, 3: 22, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!