ID: 1083750363_1083750373

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1083750363 1083750373
Species Human (GRCh38) Human (GRCh38)
Location 11:64757755-64757777 11:64757788-64757810
Sequence CCTGACCCCCAGCTTCATCCTCA CACCCACTTGGCACCCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 651} {0: 1, 1: 0, 2: 5, 3: 13, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!