ID: 1083752148_1083752157

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083752148 1083752157
Species Human (GRCh38) Human (GRCh38)
Location 11:64766682-64766704 11:64766733-64766755
Sequence CCCACGAACCTCTCCCCAGACAC CAAGATGCCCCTCCACCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 167} {0: 1, 1: 1, 2: 0, 3: 25, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!