ID: 1083758382_1083758395

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083758382 1083758395
Species Human (GRCh38) Human (GRCh38)
Location 11:64803153-64803175 11:64803189-64803211
Sequence CCGGCGCCGGGCGGGCCGGCAGG GCTGCGGAGCCGGCGCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 466} {0: 1, 1: 0, 2: 2, 3: 60, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!