ID: 1083758382_1083758397

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1083758382 1083758397
Species Human (GRCh38) Human (GRCh38)
Location 11:64803153-64803175 11:64803195-64803217
Sequence CCGGCGCCGGGCGGGCCGGCAGG GAGCCGGCGCGGGGCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 466} {0: 1, 1: 0, 2: 13, 3: 134, 4: 1010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!