ID: 1083762424_1083762432

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1083762424 1083762432
Species Human (GRCh38) Human (GRCh38)
Location 11:64825949-64825971 11:64825981-64826003
Sequence CCAGCGACTTGGGAGAGGCTGAG TTGCTCAAATGTGGGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 70, 3: 153, 4: 456} {0: 1, 1: 1, 2: 3, 3: 47, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!