ID: 1083764066_1083764076

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1083764066 1083764076
Species Human (GRCh38) Human (GRCh38)
Location 11:64833761-64833783 11:64833804-64833826
Sequence CCTCCGGCCTCAGATCTGGCTCT TCCTGAGATGCCAGGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 207} {0: 1, 1: 0, 2: 2, 3: 33, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!