ID: 1083772418_1083772422

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1083772418 1083772422
Species Human (GRCh38) Human (GRCh38)
Location 11:64875700-64875722 11:64875713-64875735
Sequence CCAGTGACCAGGGGCCCACGGGC GCCCACGGGCAGAGGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164} {0: 1, 1: 0, 2: 2, 3: 45, 4: 409}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!