ID: 1083773078_1083773089

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1083773078 1083773089
Species Human (GRCh38) Human (GRCh38)
Location 11:64879004-64879026 11:64879046-64879068
Sequence CCCTGACTACGCGCCGCGCCCGC TCCAGCTGGCTCGGAATCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56} {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!