ID: 1083781458_1083781463

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083781458 1083781463
Species Human (GRCh38) Human (GRCh38)
Location 11:64920372-64920394 11:64920398-64920420
Sequence CCCAGTGCCATGTGTGTACCACA GAAGATTAGACAGGACTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 137} {0: 1, 1: 0, 2: 1, 3: 24, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!