ID: 1083792101_1083792109

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1083792101 1083792109
Species Human (GRCh38) Human (GRCh38)
Location 11:64992516-64992538 11:64992558-64992580
Sequence CCTAGGATAGAGGATCGGGTTCT CCTTATAAGAAGAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86} {0: 1, 1: 2, 2: 31, 3: 273, 4: 1162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!