|
Left Crispr |
Right Crispr |
| Crispr ID |
1083792482 |
1083792488 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:64994853-64994875
|
11:64994897-64994919
|
| Sequence |
CCTTTTTTTTTGAGACAGAGTCT |
GTAGTGCAGCGGCTCTATCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 222, 1: 619, 2: 1120, 3: 1266, 4: 1416} |
{0: 1, 1: 3, 2: 254, 3: 7765, 4: 92832} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|