ID: 1083797586_1083797590

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083797586 1083797590
Species Human (GRCh38) Human (GRCh38)
Location 11:65026419-65026441 11:65026436-65026458
Sequence CCCTTTCCCATCTCAGCAGCTTC AGCTTCCTCAAAATTGTCGATGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 8, 3: 52, 4: 446} {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!