ID: 1083800859_1083800865

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1083800859 1083800865
Species Human (GRCh38) Human (GRCh38)
Location 11:65045573-65045595 11:65045598-65045620
Sequence CCACTTGTCTCTGAAGGCCAGGG CTCTTACAGCAGTGGCGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 224} {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!