ID: 1083811392_1083811402

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1083811392 1083811402
Species Human (GRCh38) Human (GRCh38)
Location 11:65108698-65108720 11:65108737-65108759
Sequence CCACCTGCAGGGTCTCCGGGCGG GACAGACGTCCGCCAGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 168} {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!